Humans have inhabited the Andean region as far back as 15,000 BC. The first humans were believed to migrate to these great mountains for the security they offered. However, the new region imposed an entirely new environmental stress: high altitude. In high altitudes, the oxygen level is lower and dispersed, causing lower pressure than the low-lands surrounding it. With less oxygen in the air, humans would inhale less oxygen particles into the lungs, allowing a limited supply to be absorbed by the red blood cells. In result, the red blood cells cannot carry and supply sufficient oxygen to vital organs causing hypoxia.  This greatly impacts the survival of humans in that oxygen is extremely vital to keep our bodies working properly.  

Luckily, humans are extremely adaptive in that we are a diverse species. Humans have adapted to this environmental stress through short term, facultative, developmental, and cultural types of adaptations. Imagine you plan a trip to the Andes to learn about the Quichia, the largest of any indigenous peoples in the Americas.  As you elevate, the atmosphere becomes lighter, your pulse rate and blood pressure go up causing stressful, but effective changes. This particular adaptation is only beneficial if you’re only visiting. 

                                                    

This is where a facultative adaptation would come in. If after your visit to the mountains you decide that you’re better off moving there, your body will turn on and off genes to alter a phenotypic expression in response to the stress without altering your DNA. This means the amount of oxygen your blood cells carry will increase whenever you experience a reduction in atmospheric pressure. 

                                         

After your visit, you fall in love with the people and lifestyle of the culture, so you decide to stay.  You marry a nice Quichian and have a child. These particular peoples have developed an increase in lung capacity and an increased chest size allowing an increase in pulmonary diffusion capacity. This developmental trait is a change in the DNA of the population and is called developmental adaptation. Although you lack this trait, your partner has passed it on to your child, thus giving them the advantage of survival in high altitudes.

Now, you’re learning that not only do you have to cope with the low atmospheric pressure, but you have to deal with extreme weather conditions. To keep warm in the freezing winter, the Quichian give you colorful garments made of Alpaca wool. Potatoes are freeze-dried by a special technique to preserve for the rest of the year and prepared in hot stews.

Studying human variation from this perspective across environmental clines is extremely beneficial in that we can understand how humans adapt to diverse environments.  In better understanding that adaptation to high latitudes is a gradual process, mountain climbing illnesses can be prevented. If one understands that if given the right amount of time, your body will endure a facultative adaptation giving you better oxygen supply and endurance.  Another example would be skin color. In response to high levels of solar radiation, specialized cells called melanocytes will produce a pigment called melanin to reflect the radiation. Humans in regions where there is a high level of solar radiation are darker in skin color, giving them an advantage. If scientists can develop a product that can mimic this process it can protect many people from skin cancer.

If I were to use “race” to help understand the variation of the adaptations I spoke about earlier, I would declare that the skin color, nose, and head size of the people of the Andes are all reasons to adaptation in the region. However, people of another “race” living in similar regions do not have the same skin color, nose, or head size. Therefore it is more beneficial to understand the environmental influences on adaptation to understand human variation rather than “race”.

Sources:
http://jeb.biologists.org/content/204/18/3151.full.pdf

http://www.academia.edu/1242438/Bolivian_Andes_from_climate_change_to_human_displacements_

http://www.peoplesoftheworld.org/text?people=Quichua

Our natural world is full of mysteries and wonders that ignites a desire to solve and learn its history. One of these mysteries that have troubled many humans is the evolution of humanity. Did we in fact evolve from “monkeys”? If so, where is this “missing link” that will illustrate the process?

All over Europe, early human fossils were being found, including Germany and France. England, with no trace of early human remains, felt left out on such a historic event. Were the British driven by pride to have some fossilized evidence to prove that England too was once was an inhabitant of early humans?

In 1912, amateur archaeologist Charles Dawson wrote to Arthur Smith Woodward (Keeper of Geology at the Natural History Museum) claiming that he had found a piece of a human-like skull in the gravel beds at Piltdown. Driven with excitement, the two continued over a summer to find more skull fragments, a jawbone with two teeth, and primitive stone tools. All these findings were taken as evidence of the Piltdown Man. With these fragments, Woodward reconstructed a human with a large brain, ape-like jaw with human-like teeth. Through this evidence, Dawson and Woodard believed that this was an early human relative who lived 500,000 years ago. They names this early human as Eoanthropus dawsoni.

Humans have proven themselves to be pride-driven throughout the course of history. Why else would all the great leaders of civilization strive to conquer other kingdoms, such as Alexander the Great? It makes sense that these men felt the need to find something of evolutionary value just as their neighbors. I also believe that our sense of identity leads us to make hasty conclusions. If someone were to approach you with information about what may be your family history, your first reaction is to accept it. You will try with all of your logic to verify that the information given to you is, in fact, correct. It is possible that the scientific community was so unsure of our human evolutionary past that they were willing to accept any clue and theory.

In the 40 years following, more discoveries of ancient human fossils had been made in Africa, Asia, and Europe. However, none of these discoveries showed the large brain with ape-like jaw of the Piltdown Man. In fact, all the new discoveries suggested that the” jaws and teeth became human-like before the evolution of a large brain.”(nhm.ac.uk) Kenneth Oakley ran a series of fluorine tests, which showed the fossils to be less than 50,000 years old, making it impossible to be a species with ape-like features. Joseph Weiner and Wilfrid Le Gros Clark worked with Oakley to test that the skull and jaw fragments actually came from two different species—a human and an ape. Scratches on the teeth revealed that the teeth have been filed down to make them look as if they are human. Not only that, but they revealed that some of the finds from the site have been stained artificially to match local gravels.

It is inevitable, we are human, and we cannot outrun that fact. The history of our behavior may suggest that we might repeat the same mistake once or twice, but that doesn't mean we cannot learn from our mistakes. This hoax has brought to our attention that a claim can be made, but before accepting or publicizing this theory, thorough testing should be made, if possible. With that in consideration, human factor and error is a very beneficial part of science, and should not be removed. If it weren't for inquisitive humans with the drive to understand the universe, all the sciences that very well exist would not be recognized or studied. If I could take away a life lesson from this, it would be to not rush myself. Even if I am far behind on a given project or research, it is better for me to stay true to facts and not make up stories to better myself or my country. “The truth shall set you free.”(Gospel of John 8:23)

Sources: 

http://www.nhm.ac.uk/nature-online/science-of-natural-history/the-scientific-process/piltdown-man-hoax/piltdown-hoax-revealed/index.html

Things aren't always as they seem

Just apon first glance, it is easy to differentiate between a horse and a human with simple yet obvious anatomical differences. But would you ever think that humans and horses, as well as other mammals, all share similar anatomy? Darwin himself struggled to think that finger bones could be used for holding in a human and fins in a whale. Horses and humans are not too different as well. The horses hove has overtime developed with hard, protective coverings that aided in their locomotion with speed and stability. Of course, this limited horses to use their limbs for only those purposes. Humans, on the other hand, have retained the five digit (that is, fingers and toes) that enable them to manipulate objects.


source: google images.


Horses are members of the order, Perissodactyla, and humans belong to the order, Primates. Both orders are part of the subclass Eutheria, placental mammals, and also part of the smaller group Epitheria. So the last common ancestor of horses and humans is "eomaia scansoria".

source: google images


Some animals, such as birds and bats, can appear to be related because of similar characteristics they posses. However, these similarities do not mean that they are related or belong in the same group, it just means that both species were pressured into similar morphology for better survival. Another great example of this would be the camera eye in vertebrates (particularity fish) and the octopus.


 
source: mapoflife.org                         Source: mapoflife.org

Both the eyes of cephalopods and fish are hard and nearly circular with transparent crystalline proteins. Both have developed these eyes independently for speed, resolution, and sensitivity. In particular, cephalopods are fast moving predators that need precision eyes to aid in hunting their prey.


Sources:

http://www.biolbull.org/content/210/3/308.full
http://www.hwdsb.on.ca/hillpark/Departments/Science/Watts/SBI3U/Assigned_Work/Evolution/Homologous_and_Analogous_Vestigial_and_Competition.pdf
http://www.mapoflife.org/topics/topic_7_Camera-eyes-of-cephalopods/

Protein Synthesis

AAGTACAAATTGTCTTAAGCAAGCCCCAGTTGGATCCGC

Who inspired Darwin?

"Lamarck was the first man whose conclusions on the subject excited much attention. This justly celebrated naturalist first published his views in 1801... He first did the eminent service of arousing attention to the probability of all changes in the organic, as well as the inorganic world, being the result of law, and not of miraculous interposition."

-Charles Darwin, Origin of Species pg xv

Lamarck's work and theory of evolution was never respected or credited during his lifetime. Although today he is associated with a "discredited theory of heredity", Charles Darwin, Lyell, Haekel, and other evolutionists acknowledged him as a forerunner of evolution and a great zoologist. Lamarck believed that a change in environment causes changes in the needs of organisms living in that environment which then causes changes in behavior. He developed two laws to support his idea of evolution: 1) The Law of Use and Disuse- Organs and structures that are used become more developed, organs and structures that are not used become smaller and may disappear, 2) The Law of Inheritance of Acquired Characteristics- Changes achieved over an organism's lifetime are pass on to its offspring. Although today we recognize the flaw in the second law in that only changes in sex cells will affect its offspring, Darwin used both laws in his research on evolution. 

In the Origin of Species, Darwin notes that the use and disuse theory can possibly aid in natural selection, to which he used the weak eyesight of moles and other cave dwelling animals as an example. Darwin also believed that in order for traits to evolve and change, they must be heritable. Since Darwin's research was conducted before the discovery of Mendel's law in the early 20th century, he was unable to accurately describe how traits we passed on, leaving him no choice but to use Lamarck's use and disuse theory. Darwin also shared the idea that humans choose which organisms successfully reproduce through cultivation, leading to Darwin's "artificial selection". 

Without the help of Lamarck, Darwin wouldn't have been intrigued enough to question the probability of change among species, as he stated in his book (pg xv introduction). He was so inspired by the work of Lamarck that he extensively used the same lines in his own book for support of his own theory. 

Just as Galileo was attacked for his ideas of the solar system, so did Darwin with his ideas of natural selection. Darwin was afraid to share his ideas with others; not only did his theory conflict with the beliefs of the church, but it also conflicted with the entire natural history of England. It took him years to finally publish his book Origin of Species. 

Sources:
Creation Science Association of Brittish Columbia http://www.creationbc.org/index.php?option=com_content&view=article&id=118&Itemid=54
Darwin Online http://darwin-online.org.uk/Variorum/1869/1869-xv-c-1872.html
Jean-Baptiste Lamarck http://www.ucmp.berkeley.edu/history/lamarck.html